Molecular Biology-מעבדה רפואית
- 193 שאלות
- 33 תגובות
- 0% הושלמו
- equalizer סטטיסטיקות
- share שתף
מנהלים:
Discuss, Learn and be Happy דיון בשאלות
help
brightness_4
brightness_7
format_textdirection_r_to_l
format_textdirection_l_to_r
(USMLoid) Which of the following is the major role of the 3'->5' exonuclease activity of DNA polymerases?
1
| done | ||
מיין לפי
Which of the following mechanisms can be used to fix a double stranded DNA break
1
| done | ||
| done | ||
מיין לפי
(USMLoid) Ultraviolet irradiation of cells can produce dimers between which of the following bases in DNA?
1
| done | ||
מיין לפי
CCATACACACCCC GTGGTGAGAGGAC AACTTGTCTACAG GTTATAACAGTCT CGTTCGGCACAGG TCATTGACCTTTT ACCTTGACACAGA TAGTCGATACGCA ATATTGGCAAGGA These are nine sequences from the -35 regions of 9 typical prokaryotic promoters. Which one is most likely to contain the -35 concensus sequence?
1
| done | ||
(USMLoid) The fragment of DNA shown is transcribed. Which of the following is most likely to be a product of that transcription?
1
| done | ||
מיין לפי
Match the features labeled in the diagram with the names in the following list. התאם בין הסימונים באיור לשמות מן הרשימה הבאה: i. 5' end of DNA ii. 3' end of DNA iii. 3' end of RNA iv. coding strand v. sense strand vi. template strand vii. 5' end of gene viii. 3' end of gene ix. 5' end of RNA
1
(wt) 5'- ATGGTGCATCTGACTCCTGAGGAG (mut) 5'- ATGGTGCATCTGACCCTGAGGAGA (USMLoid) Shown above are coding-strand sequences from the start of translation of the beta-globin gene. The upper sequence (wt) is normal, the lower, mut, sequence comes from a patient with beta-thalassemia. Which of the following is the most likely effect of the mutation? לפניך שני רצפים-מקודדים שנלקחו מאזור תחילת התרגום של הגן המקודד לחלבון – בטא גלובין. הרצף העליון ידוע כרצף הנורמלי (wt) ואילו הרצף התחתון נלקח מאדם החולה בבטא-תלסמיה. מה מהבאים תהיה ככל הנראה השפעתה של המוטציה?
1
| done | ||
מיין לפי
(USMLoid) In mammalian genomic DNA, methylation of C at position 5 of the pyrimidine sometimes occurs in the dinucleotide CpG. These sequences are unusually susceptible to mutation. Which of the following is the reason? ב-DNA גנומי של יונקים, מתרחשת לעיתים מתילציה בעמדה מס' 5 של הפרימידין C, כאשר הוא מופיע בקונטקסט CpG. רצפים אלו רגישים באופן יוצא דופן ליצירת מוטציות. מי מהבאים היא הסיבה?
1
| done | ||
מיין לפי
Which of the following DNA repair mechanisms is directly coupled to the transcription machinery.
1
| mood | ||
מיין לפי
Which of the following repair pathways is most likely to result in an imperfect repair? מי ממסלולי התיקון הבאים עשוי לגרום קרוב לוודאי לתיקון לא מושלם?
1
| done |
מיין לפי